~recent-questions-st | Bookmarks (1350)

We are following this documentation on how to handle errors thrown by docxtemplater. We are using TypeScript and the example seems only to work with JS. We wouldn't want to use any as a type unless necessary. How would you do this in TypeScript using correct types? function replaceErrors(key, value) { if (value instanceof Error) { return Object.getOwnPropertyNames(value).reduce( function (error, key) { error[key] =...

I have a foreground service and I starts it by: context.startForegroundService(Intent(context, MyForegroundService::class.java)) In the service, it uses START_STICKY override fun onStartCommand(intent: Intent?, flags: Int, startId: Int): Int { // do work... startForeground(ID, notification, ServiceInfo.FOREGROUND_SERVICE_TYPE_LOCATION) return START_STICKY } After the system kills the service (e.g. low on resources), it will try to recreate it later "from the background". Here we comes the problem for Anroid...

this seems just like a little quirk that I can fix just by including <cmath> where std::floor is used, but still this is weird and I'm wondering if anyone knows what's happening. I have a project, I can compile it on MSVC, GCC and Clang in C++20 and C++23, no problems. In Android Studio I can compile with C++20, but if I set C++20...

I downloaded and installed NoSQL Workbench, enabled local DynamoDB instance and created a test Data Model and a test table named Table1 on my local machine. I have the below sample code AmazonDynamoDBConfig clientConfig = new AmazonDynamoDBConfig(); clientConfig.ServiceURL = "http://localhost:8000"; var client = new AmazonDynamoDBClient(clientConfig); var table = Table.LoadTable(client, "Table1"); // <-- this line crashes var newEntry = new Document(); newEntry["ID"] = Guid.NewGuid().ToString(); newEntry["TelephoneNumber"]...

while running my azure functions, I am getting this exception in startup class. Even after installing this package error persist. System.IO.FileNotFoundException: 'Could not load file or assembly 'Microsoft.Extensions.Configuration.Abstractions, Version=9.0.0.0, Culture=neutral, PublicKeyToken=adb9793829ddae60'. The system cannot find the file specified.' this is my startup class. Project is using .net8 with v4 #region Dependency using Microsoft.Azure.Functions.Extensions.DependencyInjection; #endregion [assembly: FunctionsStartup(typeof(HROne.Events.FunctionApp.Startup))] namespace HROne.Events.FunctionApp; public class Startup : FunctionsStartup {...

I created a test application to show my problem using Blazor Hybrid with .NET MAUI (.net 9) with the AuthenticationState of a user. My test project on github: https://github.com/tPeif/blazorhybrid_authProblem There are 2 components ArticleCategoryComponentExtra and ArticleCategoryHtmlComponent.The content is wrapped in a AuthorizeView. Both components show a list of existing article categories and should show a Popup to add a new ArticeCategory by clicking the...

I am trying (for esoteric reasons that I don't wish to debate here) to write a class template whose instantiations have members that may be either functions or variables (depending on the template parameters) and which can be used with the same syntax at a given site: struct Comparable { template<class T> friend bool operator<(Comparable, T const &) { return false; } template<class T>...

Trying to pull some data out the WP Database using PHP in a child theme. $query = $wpdb->prepare( "SELECT meta_value FROM wp_postmeta WHERE post_id = %d AND meta_key = 'wp_schema_pro_optimized_structured_data'", $post_id, $meta_key ); The SQL query works when I run it in the Database tool. When I remove " AND meta_key = 'wp_schema_pro_optimized_structured_data' " the SQL works. It returns the value of a some...

So let say I have two sheets in Excel, one of them is a database table from where I pull data and the other one is a new sheet on which I construct a new table. All good until I have to copy the data validation lists from the database cells. There is a problem. If I use this method, which is basically doing...

I have a google spreadsheet with questions for a quiz and I want to extract the cells and create a google form from that spreadsheet, So I can then use it in google classroom. Gemini has written a nice code that uses google scripts, working on the spreadsheet: function createQuizFromSheet() { // Get the active spreadsheet and the sheet containing the questions var ss...

We are trying to deploy a nextJS container that works fine locally with docker but having issues when deploying to azure web app for containers. The default microsoft web page is showing on the app service url after deployment and we are having this log: 2025-04-08T10:06:36.687062300Z Now listening on: http://[::]:8081 2025-04-08T10:11:50.592316063Z Updated CA certificates 2025-04-08T10:11:53.847082392Z {"EventId":0,"LogLevel":"Information","Category":"Program","Message":"Entering app startup."} 2025-04-08T10:11:59.163231321Z Hosting environment: Production 2025-04-08T10:11:59.173450213Z Content...

I am playing with responsive behavior and I am getting the following problem. My application is divided in two vertical sections. On the left I have a navigation tree and on the right I have the datatable. The problem is that I want to resize the width of the left section because sometimes the tree became to large. I did a simple example below....

While using @JmsListener, using "concurrency" field to set max active threads for specified listener. But getting number of connection more than configured. Listener is active with below configs: @JmsListener(destination = {destination_queue}, containerFactory = {listenerContainerFactory}, concurrency = "5") As per above configurations I am expecting max 5 or less solace connections/listeners per instance of my application. But I have observed more that 5 bind-count/listeners.

Problem Description I'm experiencing a crash in my Android Compose app with LazyVerticalGrid. The error occurs seemingly randomly when users interact with the grid: IllegalStateException: entered drag with non-zero pending scroll within LazyGridState.onScroll$foundation_release What's particularly concerning is the extreme value associated with the pending scroll: 1.116108E23. This is definitely not a normal scroll value and suggests some internal state inconsistency. Important: This crash only...

I already have my Python script which returned me a file with inside a list of sequences: AGTAGAAACAAGGTCGTTTTTAAACTATTC TGGCCATCCGAATTCTTTTGGTC TGGCTGTCAGTAAG .......... .......... For every line of the file, I would like to send a request to a website: http://rna.tbi.univie.ac.at//cgi-bin/RNAWebSuite/RNAfold.cgi Each single sequence from the file has to be written as input inside a specific location of the webpage, only one sequence at the time...

I have the following syntactical problem: I want to declare a generic function of another more general, also generic type: The following example should make clear what I mean: The general type could be interface GeneralFunction<T> { (props: T): void } and now I'd like to declare a generic function f<X> of type GeneralFunction<X> (in practice imagine rather f<X> being of type GeneralFunction<g<X>> for...

I built wxWidgets in Windows with cmake cmake -G "MinGW Makefiles" /path/to/wxWidgets/ -DwxBUILD_SAMPLES=ALL cmake --build . Now I got a lot of output files in folders build\samples\CMakeFiles about.dir access.dir animate.dir ... And within them a lot of obj files were created. How can I make them executable exe files?

In our Telegram WebApp I open an iframe to another website, and it does a top-level redirect after the form is submitted (i.e. it redirects our WebApp URL, not the iframe). I tried using service workers (to track current window URL changes), as well as subscribing to onbeforeunload, however there's a problem with Safari browser that doesn't have this event, and also that worker's...

I build myself the following code in order to uninstall MS Teams (personal) from the computer. My goal is to uninstall it from every user profile on the PC and in the best case if a new user logs in, it should not be installed or appear for that user. # Check, if "MS Teams (personal)" is installed, stop (if necessary) and then proceed...

I have 4 columns c1, c2, c3, c4 in a table and some non-additive aggregate function f (for example, sum of prices divided by sum of quantities or nested listaggs of countries, cities, counteragents, etc.). I want to make a sequence of aggregations: f(c4) group by c1, c2, c3 as a3 -> f(a3) group by c1, c2 as a2 -> f(a2) group by c1...

I'm using ggplot2 in R to create a dotplot where the x-axis is the variable name and the y-axis is the cell line ID. The plot is faceted by a Group variable ("Foci formation", "Soft agar", "3D Matrigel growth"). I want to rotate or flip the entire plot horizontally, so that: What is currently on the left becomes the right (and vice versa). The...

I want to implement a chatbot in python but I'm having a problem implementing it since the agent I'm using which is based on GPT o3 mini high doesn't generalize well and also doesn't take information out of the knowledge base.

<script> let checked = <?php echo $row["restriction"] ?>; console.log(checked); </script> When I was using a JS variable with let to store a php value, this output appears with errors: 1 userManage.php:88 Uncaught SyntaxError: Identifier 'checked' has already been declared (at userManage.php:88:49) userManage.php:109 Uncaught SyntaxError: Identifier 'checked' has already been declared (at userManage.php:109:49) userManage.php:130 Uncaught SyntaxError: Identifier 'checked' has already been declared (at userManage.php:130:49) The...

I want to extract all capital company names from text. I have worked on a two regular expression. r'\b[A-Z](?:A-Z \t&.-?)*(?:\b|(?<=)))' \b(?:[A-Z&.-]+\s+)*[A-Z&.-]+\s+(?:LIMITED|LTD|GROUP(?:\s+LIMITED)?)\b The issue with first one is that it captures all caps words like CO, COSED and names from text. The issue with second one is that companies always not have LIMITED|LTD|GROUP. Is there a way that we can extract just company names from...